Student Seminar Report & Project Report With Presentation (PPT,PDF,DOC,ZIP)
General Talks
General Discussion
Projects and Seminars
cryptography with dna binary code

New Reply

Threaded Mode | Linear Mode

cryptography with dna binary code

Guest
Guest

07-11-2013, 09:37 AM

please give me a code to convert binarary code to dna

Guest
Guest

03-07-2014, 12:31 AM

ATGATTAAGCCTAGGTGCTCGCTTCGCTGCGTTCGGTTTCCATTTCCACAATAAAATAGGTGTTTTCCACTTCGCTATGGCAGCGCGCCATGG

Guest
Guest

16-07-2014, 04:42 PM

i want 2 buy lottery ticket first time...i have registerd

« Next Oldest | Next Newest »

New Reply

Important Note..!

If you are not satisfied with above reply ,..Please

ASK HERE

So that we will collect data for you and will made reply to the request....OR try below "QUICK REPLY" box to add a reply to this page

Quick Reply

Message
Type your reply to this message here.

Disable Smilies

Image Verification
Please enter the text contained within the image into the text box below it. This process is used to prevent automated spam bots.

(case insensitive)

Possibly Related Threads...
Thread		Author	Replies	Views	Last Post
	embedded extended visual cryptography schemes ppt	ksumanth225	5	3,263	19-03-2018, 11:02 PM Last Post: Guest
	source code in c for dna cryptography in computer sc ppt		1	1,533	09-01-2018, 09:59 PM Last Post: harshavarshinib
	color extended visual cryptography matlab code		1	856	13-04-2017, 02:29 PM Last Post: jaseela123d
	quantum cryptography ieee papers free download		1	955	13-04-2017, 01:12 PM Last Post: jaseela123d
	matlab code for adaptive differential pulse code modulation		1	1,131	04-04-2017, 11:49 AM Last Post: jaseela123d
	color extended visual cryptography matlab code		1	882	31-03-2017, 12:43 PM Last Post: jaseela123d
	security system for dns using cryptography		1	620	27-03-2017, 12:59 PM Last Post: jaseela123d
	visual cryptography pdf		1	704	17-03-2017, 12:43 PM Last Post: jaseela123d
	abstract for dna computing in ieee format		1	595	14-03-2017, 11:50 AM Last Post: jaseela123d
	future scope of palladium cryptography pdf		1	752	24-02-2017, 02:43 PM Last Post: jaseela123d

Forum Jump: